Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai , China
|
|
- Calvin Robinson
- 5 years ago
- Views:
Transcription
1 Small Molecule Modulation of Wnt Signaling via Modulating the Axin-LRP5/6 Interaction Sheng Wang 1#, Junlin Yin 2#, Duozhi Chen 2, Fen Nie 1, Xiaomin Song 1, Cong Fei 1, Haofei Miao 1, Changbin Jing 3, Wenjing Ma 3, Lei Wang 2, Sichun Xie 1, Chen Li 4, Rong Zeng 4, Weijun Pan 3, Xiaojiang Hao 2 * and Lin Li 1 * 1 State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai , China 2 State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming , China 3 Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences & Shanghai Jiao Tong University School of Medicine, Shanghai , China. 4 Key Laboratory of Systems Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai , China # These authors contributed equally to this work. * Correspondence: Lin Li, lli@sibs.ac.cn; and Xiaojiang Hao, haoxj@mail.kib.ac.cn.
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22 Supplementary Table 1: Primers used for real-time quantitative PCR assays Genes Forward primers (5-3 ) Reverse primers (5-3 ) AXIN2(Homo sapiens) DKK1 (Homo sapiens) NKD1 (Homo sapiens) GAPDH (Homo sapiens) cdx4 (Danio rerio) tbx6 (Danio rerio) ntl(danio rerio) runnx1 (Danio rerio) cmyb (Danio rerio) AGGCTAGCTGAGGTGT CTGCAAAAATGGAATATGTGT GTCAACCACTCCCCAACATC AGGTCGGAGTCAACGGATTTG CTCCGGGACCAGTTTCCTAT CAAGCTGGATTTGACTGCAA GAAAGTCGGTGGGATTCAGA CGTCTTCACAAACCCTCCTCAA GAACGGCTACGGTGGCTGG AGGCTTGGATTGGAGAA CTTCTTGTCCTTTGGTGTGA AATGGTGGTAGCAGCCAGAC TGTAAACCATGTAGTTGAGGTCA CTCCTTCGTTCTCGTTTTGC GGGGTTTGTGAAGGCTGATA TCTGGGACTTCCTTGTGGTC GCTTTACTGCTTCATCCGGCT CGTTATTTGGGCTGTTTGTGTTGC gapdh (Danio rerio) CAGGCATAATGGTTAAAGTTGGTA CATGTAATCAAGGTCAATGAATGG
23 Supplementary Table 2: Primers used for Axin mutation constructs Mutants Primers R765A Forward primers (F), Reverse primers (R) CACCCTGGTGGCGGGCCGCGCTGTCAC GTGACAGCGCGGCCCGCCACCAGGGTG E776A GCCAGTTCAAGGCGCTGCTGACCAAA TTTGGTCAGCAGCGCCTTGAACTGGC K780S GCTGCTGACCAGTAAGGGCAGCTACAG CTGTAGCTGCCCTTACTGGTCAGCAGC V810R GAGGACGAGGCCCGCCTGCCCGTCTTTG CAAAGACGGGCAGGCGGGCCTCGTCCTC resistant to Axin sirna CTGAAGCTGGCAAGAGCAATCTACAGGAAGTACATTC GAATGTACTTCCTGTAGATTGCTCTTGCCAGCTTCAG Supplementary Table 3: sirna sequences for the targeted genes as indicated Knockdown constructs Target sequences (5-3 ) Si-Axin Si-Axin2 NC ( negative control) CGAGAGCCAUCUACCGAAATT AGACGAUACUGGACGAUCATT UUCUCCGAACGUGUCACGUTT
24 Supplementary Table 4: Small molecule screening data Category Parameter Description Assay Type of assay Cell-based Target Primary measurement Key reagents Wnt/β-catenin signaling pathway Detection of Firefly luciferase enzyme activities and GFP expression TOPFlash (Millipore) and Luciferase Assay (Roche) Assay protocol HEK293T cells were seeded in 48-well plates. Each well of HEK293T cells was transfected with 125 ng of plasmids in total, including 10 ng of TOPFlash and 115 ng of LacZ plasmid. 18 hrs later, cells were treated for 1 hr with small molecule (10 µm) followed by control conditioned medium (CM) or Wnt3a CM plus the same dose of small molecule for additional 6 hrs before luciferase activity assays. The luciferase enzyme activities were determined for Wnt signaling activity; And, GFP expression levels were determined for normalization. Additional comments The postive small molecule only impacted luciferase enzyme activities and did not impact GFP expression levels. Library Library size approximately 200 Library composition Source Additional comments synthetic chemical compounds Screen Format 48-well, Corning 3548 Concentration(s) tested Plate controls Reagent/ compound dispensing system Detection instrument and software Assay validation/qc Correction factors Normalization Additional comments State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany, Chinese Academy of Sciences no 10 µm, 1% DMSO NC043 Manual Synergy 2 (BioTek) NC043 inhibits Wnt signaling. no luciferase enzyme activities were normalized by GFP expression levels. no Post-HTS analysis Hit criteria TOPFlash Fluc/GFP ratio > 2 standard deviations from the mean; or TOPFlash Fluc/GFP ratio < 0.5 standard deviations from the mean Hit rate Approximately 0.5% Additional assay(s) Confirmation of hit purity and structure Additional comments FOPflash reporter assay in HEK 293 Cells. TOPflash Wnt signaling reporter assay with LiCl in HEK 293 Cells, and immunoblotting for intra-cellular levels of the cytosolic and nuclear β-catenin. Compounds were verified analytically. no
25 Supplementary References 1 Wang, W., Liu, H., Wang, S., Hao, X. & Li, L. A diterpenoid derivative 15-oxospiramilactone inhibits Wnt/beta-catenin signaling and colon cancer cell tumorigenesis. Cell Research 21, (2011).
26 Supplementary Notes Synthesis and information of HLY78 and its analogs. 5-methyl-4-vinyl-5,6-dihydro-[1,3]dioxolo[4,5-j]phenanthridine (HLY72) -- The solution of (+)-lycorine (300 mg, 1 mmol) in DMF (10 ml) was put into a round-bottomed flask, following the CH 3 I (400 μl, 2 mmol) and stirred at room temperature for 12 hrs. The reaction solution was evaporated to remove DMF and then was charged with potassium tert-butoxide (PTB, 1.1 g, 10 mmol) and T-BuOH (TBA, 10 ml). The mixture was heated to 90 C and stirred for 4 hrs. The mixture was diluted in 50 ml saturated NH 4 Cl and Then with EtO 2 (20 ml) for twice and the organic phase was washed with saturated NH 4 Cl, brine, dried over MgSO 4, filtered, and concentrated. The residue was purified by column chromatography with petroleum ether-etoac (5:1) to give HLY72 as pale yellow solid (240 mg, yield 90%). mp: C ; 1 H NMR (400 MHz, CDCl 3 ): δ 7.58 (d, J = 7.7 Hz, 1H), 7.47 (d, J = 7.7 Hz, 1H), 7.26 (dt, J = 10.7, 7.1 Hz, 2H), 7.16 (t, J = 7.7 Hz, 1H), 6.72 (s, 1H), 5.99 (s, 2H), 5.75 (d, J = 17.8 Hz, 1H), 5.32 (d, J = 11.1 Hz, 1H), 4.03 (s, 2H), 2.51 (s, 3H); 13 C NMR (100 MHz, CDCl 3 ) : δ147.4 (C), (C), (CH), (C), (C), (C), (C), (CH), (CH), (CH), (CH 2 ), (CH), (CH), (CH 2 ), 54.8 (CH 2 ), 41.5 (CH), ESI + MS (m/z): 266 [M+H] +. 4-ethyl-5-methyl-5,6-dihydro-[1,3]dioxolo[4,5-j]phenanthridine (HLY78) -- HLY72 (27 mg, 0.1 mmol) and TsNHNH 2 was dissolved in THF/H 2 O (5 ml, 4:1) and the solution was heated to refulx for 4 h then the mixture was cooled down and charged with NaOAc (73.8 mg, 0.3 mmol) followed with NH 4 Cl (10 ml, 2 M). The solution was extracted with Et 2 O (30 ml) for twice. The organic layer was washed with brine, dried over MgSO 4, filtered, and concentrated. The residue was purified by column chromatography with petroleum ether-etoac (20:1) as eluent to afford HLY78 as a solid (25 mg, yield 95%). mp: C ; 1 H NMR (400 MHz, MeOD) : δ7.51 (t, J = 8.4 Hz, 1H), 7.28 (d, J = 6.4 Hz, 2H), 7.20 (t, J = 7.9 Hz, 2H), 6.75 (s,
27 1H), 6.01 (s, 1H), 4.01 (s, 2H), 2.83 (q, J = 7.5 Hz, 2H), 2.50 (s, 3H), 1.32 (dd, J = 15.7, 8.2 Hz, 3H); 13 C NMR (100 MHz, CDCl 3 ) : δ147.3 (C), (C), (C), (C), (C), (CH), (C), (C), (CH), (CH), (CH), (CH), (CH 2 ), 55.2 (CH 2 ), (CH), 23.1 (CH 2 ), 14.8 (CH 3 ), HREIMS (m/z): [M] + calcd for C 17 H 17 NO 2, ; found, ethyl-5-methyl-5,6-dihydrophenanthridine-8,9-diol (HLY119) -- A dry round-bottomed flask was charged with HLY78 (55 mg, 0.2 mmol) and CH 2 Cl 2 (10 ml). The reactor was then cooled to -78 C and BBr 3 (200 μl, 0.4 mmol) was added. The mixture was stirred for 6 h and diluted in 50 ml saturated NaHCO 3. It was extracted with CH 2 Cl 2 (20 ml) for twice. The organic layer was washed with brine and concentrated. The residue was purified by column chromatography with chloroform-methanol (20:1) as eluent to give 5 as a pale yellow solid (35.7 mg, yield 70%). 1 H NMR (400 MHz, CDCl 3 ) : δ7.46 (d, J = 7.1 Hz, 1H), 7.27 (d, J = 2.7 Hz, 1H), (m, 2H), 6.75 (s, 1H), 3.96 (s, 2H), 2.79 (q, J = 7.5 Hz,2H), 2.47 (s, 3H), 1.28 (dd, J = 14.7, 7.1 Hz, 3H); 13 C NMR (100 MHz, CDCl 3 ) : δ143.8 (C), (C), (C), (C), (CH), (C), (C), (CH), (CH), (CH), (C), (CH), 54.6 (CH 2 ), 41.2 (CH 3 ), 23.1 (CH 2 ), 14.8 (CH 3 ); ESI + MS (m/z): 256 [M+H] +. 5,6-Dihydrobicolorine (Hss49a) -- This compound is a alkaloid which was isolated from lycoris rasiata. 1 H NMR (CDCl 3, 400 MHz) : δ7.30 (m, 1H,), 7.02 (s, 1H, H-7), 7.01 (m, 1H,), 6.85 (m, 1H), 6.76 (m, 1H), 6.69 (s, 1H, H-10), 6.01 (s, 2H,,-OCH 2 O-), (m, 2H, H-6); 13 C NMR (CDCl 3, 400 MHz) : δ147.6, (C) (C), (C), (C), (C), (CH), (CH), (CH), (CH), (C), (CH), (CH), (CH 2, -OCH 2 O-), 63.8 (CH 2 ), 30.8 (CH 3 ); ESI + MS (m/z): 258 [M+H] +. 5,7-dihydro-4H-[1,3]dioxolo[4,5-j]pyrrolo[3,2,1-de]phenanthridine (HLY103) -- Lycorine (28.7mg, 0.1mmol) was dissolved in DMF (2 ml) then added Burgess regant (47.6mg, 0.2mmol). The mixture was strried at 50 C for 2 hrs under N 2 then concentrated in vacuo, and the residue was purified by column chromatography with
28 petroleum ether-etoac (100:1) to give HLY103 as a colorless solid (17.5mg, 70%). 1 H NMR (400 MHz, CDCl 3 ) : δ7.27 (t, J = 5.5 Hz, 1H), 7.18 (d, J = 9.8 Hz, 1H,), 7.01 (d, J = 7.3 Hz, 1H), 6.77 (t, J = 7.5 Hz, 1H), 6.63 ( s, 1H), 5.96 (s, 2H), 4.06 (s, 2H), 3.32 (t, J = 7.9 Hz, 2H), 3.02 (t, J = 8.0 Hz, 2H); 13 C NMR (100 MHz, CDCl 3 ) : δ149.5 (C), (C), (C), (C), (C), (C), (C), (CH), (CH), (CH), (CH), (CH), (CH 2 ), 55.4 (CH 2 ), 53.5 (CH 2 ), 29.0 (CH 2 ); ESI - MS (m/z): 250 [M-H] -. Synthesis and information of HLY179 and its intermediates. 4-ethyl-5-methyl-8,9-bis(prop-2-tri-azole-ethylamineoxy)-5,6-dihydrophenan thridine (HLYC60) -- To HLYC175 (9) (22 ml, 0.25 mmol) in H 2 O/tBuOH (2mL, 1:1) was added HLY165a (66.0 mg, 0.2 mmol), followed by CuSO 4 (3.0 mg) and sodium ascorbate solution (50 μl, 1 M solution). The solution was stirred for 15 hrs at r.t. then was concentrated in vacuo, and the residue was purified by column chromatography with chloroform-methanol (9:1) to give HLYC60 as a waxy stuff (60 mg, 55%). 1 H NMR (400 MHz, CDCl 3 ) : δ7.78 (m, 1H), (m, 3H), (m, 3H), (m, 8H), (m, 2H), 4.42 (s, 1H), 3.50 (s, 2H), 3.45 (s, 2H), 2.78 (d, J = 8 Hz, 2H), 2.44 (s, 3H), 1.27 (t, J = 8.0 Hz, 3H); 13 C NMR (150 MHz, CDCl 3 ) : δ (C), (C), (C), (C), (CH), (C), (C), (C), (CH), (CH), (CH), (CH), (C), (C), (CH), (CH), (CH 2 ), (CH 2 ), (CH 2 ), (CH 2 ), (CH 2 ), (CH 3 ), (CH 2 ), (CH 2 ), (CH 2 ), (CH 3 ); HREIMS (m/z): [M] + calcd for C 26 H 33 N 9 O 2, ; found, (R,S,S)-N,N'-(2,2'-(4,4'-(4-ethyl-5-methyl-5,6-dihydrophenanthridine-8,9-diyl )bis(oxy)bis(methylene)bis(1h-1,2,3-triazole-4,1-diyl))bis(ethane-2,1-diyl))bis(5-(( 3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide) (HLY179) -- To HLYC177 (68.6 mg, 0.22 mmol) in H 2 O/tBuOH (2 ml, 1:1) was added HLY165a (10) (33.1 mg, 0.1 mmol), followed by CuSO 4 (1.8 mg) and sodium ascorbate solution (30 μl, 1 M solution). The solution was stirred for 12 hrs at 50 C.
29 then was concentrated in vacuo, and the residue was purified by column chromatography with chloroform-methanol (9:1) to give HLY179 as a colorless solid (57.3 mg, 60%). mp: C ; 1 H NMR (400 MHz, MeOD) : δ7.96 (s, 1H), 7.95 (s, 1H), (m, 1H), 7.46 (s, 1H), (m, 2H), 6.97 (s, 1H), 5.24 (s, 2H), 5.21 (s, 2H), (m, 6H), (m, 2H), (m, 2H), (m, 2H), (m, 4H), (m, 4H), (m, 2H), 2.43 (s, 3H), (m, 4H), (m, 8H), (m, 4H), 1.28 (t, J = 7.1 Hz, 3H); 13 C NMR (100 MHz, CDCl 3 ) : δ176.42, , , , , , , , , , , , , , , , , , , , , , , , , , , , 92.87, 89.43, 62.94, 62.41, 61.37, 59.65, 55.06, 54.05, 41.63, 40.49, 39.58, 38.68, 34.89, 27.76, 27.51, 24.85, 22.55, 14.04, 10.24; HREIMS (m/z): [M] + calcd for C 46 H 61 N 13 O 6 S 2, ; found, ethyl-5-methyl-8,9-bis(prop-2-ynyloxy)-5,6-dihydrophenanthridine (HLY165a) -- HLY119 (26 mg, 0.1 mmol) dissolved in dry THF (3 ml), following added NaH (10 mg, 0.4 mmol) and propargyl bromide (20 μl, 0.25mmol). The mixture was stirred at room temperature for 24 hrs and then quenched by water (50 ml) in an ice bath. The reaction solution was evaporated to remove THF and extracted with CH 2 Cl 2 (30 ml) for twice. The organic layer was washed with saturated NaHCO 3, brine, dried over MgSO 4, filtered, and concentrated. The residue was purified by column chromatography with petroleum ether-etoac (9:1) as eluent to afford HLY165a as a solid (26.5 mg, yield 80%). 1 H NMR (400 MHz, CDCl 3 ) : δ 1 H NMR (400 MHz, CDCl 3 ) δ: 7.54 (d, J = 6.9 Hz, 1H), 7.46 (s, 1H), (m, 2H), 6.91 (s, 1H), 4.83 (s, 2H), 4.80 (s, 2H), 4.02 (s, 2H), (m, 2H), (m, 2H), 2.47 (s, 3H), (m, 3H); 13 C NMR (100 MHz, CDCl 3 ) δ: (C), (C), (C), (C), (C), (CH), (C), (C), (CH), (CH), (CH), (CH), 78.6 (C), 78.4 (C), 75.9 (CH), 75.8 (CH), 57.2 (CH 2 ), 56.9 (CH 2 ), 54.8 (CH 2 ), (CH 3 ), 23.1 (CH 2 ), 14.8 (CH 3 ); ESI - MS (m/z): 330[M-H] -.
30 2,5-dioxopyrrolidin-1-yl-5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]i midazol-4-yl)pentanoate (HLYC176 (11)) -- A solution of D-biotin (24 mg, 0.1 mmol) in DMF (10 ml) was added with pyridine (2 ml) and DCC (41 mg, 0.2 mmol). The mixture was stirred for 0.5 h and then charged with N-Hydroxusuccinimide (13.8 mg, 0.12 mmol). The solution was stirred for 24 hrs at r.t. then was concentrated in vacuo, and the residue recrystallized from propanol to give HLYC176 as a colorless solid (22 mg, 65%). mp: C ; 1 H NMR (400 MHz, [D6]DMSO) : δ6.42 (s, 1 H, 3-NH), 6.36 (s, 1 H, 1-NH), (m, 1 H, 6a-H), (m, 1 H, 3a-H), (m, 1 H, SCH), (m, 5 H, CH 2 CH 2 (succinyl), SCH 2 ), 2.66 (t, J = 7.3 Hz, 2 H, 2'-H), 2.57 (d, J = 11.4 Hz, 1 H, SCH 2 ), (m, 3 H, 3'-H, 5'H), (m, 3 H, 4'-H, 5'-H); 13 C NMR (100 MHz, [D6]DMSO) : δ170.3 (N(CO) 2 ), (CO 2 ), ((HN) 2 CO), 61.0 (C-3a), 59.2 (C-6a), 55.2 (SCH), 39.9 (SCH 2 ), 30.0 (C-2'), 27.8 (C-4'), 27.6 (C-5'), 25.4(CH 2 CH 2 (succinyl)), 24.3 (C-3'); ESI + MS (m/z): 342[M+H] +. N-(2-azidoethyl)-5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol- 4-yl)pentanamide (HLYC177) -- HLYC176 (34 mg, 0.1 mmol) and HLYC175 (17 mg 0.2 mmol) was dissolved in DMF (2 ml) and then Et 3 N (12 mg, 1.2 mmol) was added. The solution was stirred for 24 hrs at r.t. then was concentrated in vacuo, and the residue was purified by column chromatography with chloroform-methanol (20:1) to give HLYC177 as a colorless waxy stuff (23 mg, 70%). 1 H NMR (400 MHz, [D6]DMSO) δ: 8.03 (t, J = 5.3 Hz, 1 H,CONH), 6.42 (s, 1 H, 3-NH), 6.35 (s, 1 H, 1-NH), (m, 1 H, 6a-H), (m, 1 H, 3a-H), 3.31 (d, J = 7.6 Hz, 2 H, CH 2 N 3 ), (m, 2H, CH 2 CH 2 N 3 ), (m, 1H, SCH), 2.80 (dd, J = 12.4, 5.1 Hz, 1 H, SCH 2 ), 2.56 (d, J = 12.9 Hz, 1H, SCH 2 ), 2.06 (t, J = 7.3 Hz, 2H, 2'-H), (m, 1H, 5'-H), (m, 3H, 3'-H, 5'-H), (m, 2H, 4'-H); 13 C NMR (100 MHz, [D6]DMSO) δ: (CONH), ((HN) 2 CO), 61.0 (C-3a), 59.2 (C-6a), 55.4 (SCH), 50.0 (CH 2 N 3 ), 39.9 (SCH 2 ), 38.1 (CH 2 CH 2 N 3 ), 35.1 (C-2'), 28.2 (C-4'), 28.0 (C-5'), 25.2 (C-3'); HRESI + MS (m/z): [M+H] + calcd for C 12 H 20 N 6 O 2 S + H, ; found,
31 2-Azidoethylamine (HLYC175) -- 2-Bromoethylamine hydrobromide (500 mg, 2.44 mmol) and sodium azide (475.9 mg, 7.32 mmol) was dissolved in H 2 O (2 ml), The mixture was heated to 75 C and stirred for 21 hrs then was cooled down to 0 C. KOH (800 mg) and Et 2 O (2 ml) was added, the solution was extracted with Et 2 O (2 10 ml), then concentrated in vacuo, and the residue was purified by column chromatography with chloroform-methanol (20:1) to give HLYC175 as a colorless liquid (171 mg, 82%). 1 H NMR (400 MHz, CDCl 3 ) : δ3.30 (t, J = 5.7 Hz, 2 H, CH 2 NH 2 ), (m, 2 H, CH 2 N 3 ), 1.27 (s, 2 H, NH 2 ); 13 C NMR (100 MHz, CDCl 3 ) δ: 54.6 (CH 2 N 3 ), 41.2 (CH 2 NH 2 ); ESI + MS (m/z): 87 [M+H] +.
32 Supplementary Chemical Compound Information HLY72 1
33 HLY78 2
34 HLY119 3
35 HSS49a 4
36 HLY179: 5
37 HLYC60 6
Insight into the complete substrate-binding pocket of ThiT by chemical and genetic mutations
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Insight into the complete substrate-binding pocket of ThiT
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Valuable Building Block for the Synthesis of Lunularic Acid, Hydrangeic Acid and their Analogues Ramesh Mukkamla a, Asik Hossain a & Indrapal Singh Aidhen a * a Department of Chemistry,
More informationMetal-Free One-Pot α-carboxylation of Primary Alcohols
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2016 Metal-Free One-Pot α-carboxylation of Primary Alcohols Gydo van der Heijden,
More informationSUPPLEMENTARY INFORMATION. SYNTHESIS OF NEW PYRAZOLO[1,5-a]QUINAZOLINE DERIVATES
SUPPLEMENTARY INFORMATION SYNTHESIS OF NEW PYRAZOLO[1,5-a]QUINAZOLINE DERIVATES Dániel Kovács, Judit Molnár-Tóth, Gábor Blaskó G, Imre Fejes, Miklós Nyerges* a Servier Research Institute of Medicinal Chemisrty,
More informationDesign of NIR Chromenylium-Cyanine Fluorophore Library for Switch-ON and Ratiometric Detection of Bio-Active Species in Vivo
Supporting information for Design of NIR Chromenylium-Cyanine Fluorophore Library for Switch-ON and Ratiometric Detection of Bio-Active Species in Vivo Yanfen Wei, Dan Cheng, Tianbing Ren, Yinhui Li, Zebing
More information2-Hydroxyindoline-3-triethylammonium Bromide: A Reagent for Formal C3-Electrophilic Reactions of. Indoles
2-Hydroxyindoline-3-triethylammonium Bromide: A Reagent for Formal C3-Electrophilic Reactions of Indoles Takumi Abe*, Takuro Suzuki, Masahiro Anada, Shigeki Matsunaga, and Koji Yamada* Faculty of Pharmaceutical
More informationPalladium Catalyzed Amination of 1-Bromo- and 1-Chloro- 1,3-butadienes: a General Method for the Synthesis of 1- Amino-1,3-butadienes
Supporting Information Palladium Catalyzed Amination of 1-Bromo- and 1-Chloro- 1,3-butadienes: a General Method for the Synthesis of 1- Amino-1,3-butadienes José Barluenga,* [a] Fernando Aznar, [a] Patricia
More informationPhosphine oxide-catalyzed dichlorination reactions of. epoxides
Phosphine oxide-catalyzed dichlorination reactions of epoxides Ross M. Denton*, Xiaoping Tang and Adam Przeslak School of Chemistry, The University of Nottingham, University Park, Nottingham, NG 2RD, United
More informationDithiocarbonic acid S-{[(1-tert-butylcarbamoyl-propyl)-prop-2-ynylcarbamoyl]-methyl}
General procedure for the synthesis of Ugi adducts: To a 1 M solution of aldehyde (1 mmol) in methanol were added successively 1 equiv. of amine, 1 equiv. of chloroacetic acid and 1 equiv. of isocyanide.
More informationElectronic Supplementary Material (ESI) for RSC Advances This journal is The Royal Society of Chemistry 2013
SUPPORTING INFORMATION Hetero Diels-Alder Reaction of Olefin with o-quinone Methides Generated Using ( )-Binolphosphoric Acid for the Stereoselective Synthesis of 2,4 Diarylbenzopyrans: Application to
More informationVisible light promoted thiol-ene reactions using titanium dioxide. Supporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Visible light promoted thiol-ene reactions using titanium dioxide Venugopal T. Bhat, Petar A. Duspara,
More informationAn Environment-Friendly Protocol for Oxidative. Halocyclization of Tryptamine and Tryptophol Derivatives
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information An Environment-Friendly Protocol for Oxidative Halocyclization
More informationSUPPORTING INFORMATION
Chemoselective Aromatic C-H Insertion of α-diazo-β-ketoesters Catalyzed by Dirhodium(II) Carboxylates Esdrey Rodriguez-Cárdenas, a Rocío Sabala, b Moisés Romero-rtega, a Aurelio rtiz, b and Horacio F.
More informationExperimental Section. General information
Supporting Information Self-assembly behaviour of conjugated terthiophene surfactants in water Patrick van Rijn, a Dainius Janeliunas, a Aurélie M. A. Brizard, a Marc C. A. Stuart, b Ger J.M. Koper, Rienk
More informationRegioselective C-H bond functionalizations of acridines. using organozinc reagents
Supporting Information Regioselective C-H bond functionalizations of acridines using organozinc reagents Isao Hyodo, Mamoru Tobisu* and Naoto Chatani* Department of Applied Chemistry, Faculty of Engineering,
More informationSupporting Information Reaction of Metalated Nitriles with Enones
Supporting Information Reaction of Metalated Nitriles with Enones Hans J. Reich,* Margaret Biddle and Robert Edmonston Department of Chemistry, University of Wisconsin Madison, Wisconsin 53706 reich@chem.wisc.edu
More informationEnantioselective Synthesis of ( )-Jiadifenin, a Potent Neurotrophic Modulator
Enantioselective Synthesis of ( )-Jiadifenin, a Potent Neurotrophic Modulator Lynnie Trzoss, Jing Xu,* Michelle H. Lacoske, William C. Mobley and Emmanuel A. Theodorakis* Department of Chemistry and Biochemistry,
More informationSupporting Information
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique Singular Supramolecular Self-assembling
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Radical Aminooxygenation of Alkenes with N-fluorobenzenesulfonimide (NFSI)
More informationCobalt-catalyzed reductive Mannich reactions of 4-acryloylmorpholine with N-tosyl aldimines. Supplementary Information
Supplementary Information 1 Cobalt-catalyzed reductive Mannich reactions of 4-acryloylmorpholine with -tosyl aldimines scar Prieto and Hon Wai Lam* School of Chemistry, University of Edinburgh, Joseph
More informationSupporting Information. Improved syntheses of high hole mobility. phthalocyanines: A case of steric assistance in the
Supporting Information for Improved syntheses of high hole mobility phthalocyanines: A case of steric assistance in the cyclo-oligomerisation of phthalonitriles Daniel J. Tate 1, Rémi Anémian 2, Richard
More informationSuzuki-Miyaura Coupling of NHC-Boranes: a New Addition to the C-C Coupling Toolbox
Supporting Information Suzuki-Miyaura Coupling of HC-Boranes: a ew Addition to the C-C Coupling Toolbox Julien Monot, a Malika Makhlouf Brahmi, a Shau-Hua Ueng, a Carine Robert, a Marine Desage-El Murr,
More informationBase catalyzed sustainable synthesis of phenyl esters from carboxylic acids using diphenyl carbonate
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Base catalyzed sustainable synthesis of phenyl esters from carboxylic acids using diphenyl
More informationDirected Studies Towards The Total Synthesis of (+)-13-Deoxytedanolide: Simple and Convenient Synthesis of C8-C16 fragment.
Directed Studies Towards The Total Synthesis of (+)-13-Deoxytedanolide: Simple and Convenient Synthesis of C8-C16 fragment Sébastien Meiries, Alexandra Bartoli, Mélanie Decostanzi, Jean-Luc Parrain* and
More informationGold-catalyzed domino reaction of a 5-endo-dig cyclization and [3,3]-sigmatropic rearrangement towards polysubstituted pyrazoles.
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 SUPPORTING INFORMATION Gold-catalyzed domino reaction of a 5-endo-dig cyclization
More informationSupporting Information
Supporting Information Enantioselective Cyclopropanation of Indoles Construction of all-carbon Quaternary Stereocentres Gülsüm Özüduru, Thea Schubach and Mike M. K. Boysen* Institute of Organic Chemistry,
More informationA simple, efficient and green procedure for Knoevenagel condensation catalyzed by [C 4 dabco][bf 4 ] ionic liquid in water. Supporting Information
A simple, efficient and green procedure for Knoevenagel condensation catalyzed by [C 4 dabco][bf 4 ] ionic liquid in water Supporting Information Da-Zhen Xu, Yingjun Liu, Sen Shi, Yongmei Wang* Department
More informationGold(I)-Catalyzed Formation of Dihydroquinolines and Indoles from N-Aminophenyl propargyl malonates
Gold(I)-Catalyzed Formation of Dihydroquinolines and Indoles from -Aminophenyl propargyl malonates Colombe Gronnier, Yann Odabachian, and Fabien Gagosz* Laboratoire de Synthèse Organique, UMR 7652 CRS
More informationNitro-enabled catalytic enantioselective formal umpolung alkenylation of β-ketoesters
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Nitro-enabled catalytic enantioselective formal umpolung alkenylation of β-ketoesters Abhijnan
More informationSupporting Information
Supporting Information Late-Stage Peptide Diversification by Bioorthogonal Catalytic C H Arylation at 238C inh 2 O Yingjun Zhu, Michaela Bauer, and Lutz Ackermann* [a] chem_201501831_sm_miscellaneous_information.pdf
More informationPreparation of N-substituted N-Arylsulfonylglycines and their Use in Peptoid Synthesis
- Supporting Information (SI) - Preparation of N-substituted N-Arylsulfonylglycines and their Use in Peptoid Synthesis Steve Jobin, Simon Vézina-Dawod, Claire Herby, Antoine Derson and Eric Biron* Faculty
More informationA New Acyl Radical-Based Route to the 1,5- Methanoazocino[4,3-b]indole Framework of Uleine and Strychnos Alkaloids
A ew Acyl Radical-Based Route to the 1,5- Methanoazocino[4,3-b]indole Framework of Uleine and Strychnos Alkaloids M.-Lluïsa Bennasar,* Tomàs Roca, and Davinia García-Díaz Laboratory of Organic Chemistry,
More informationFirst enantioselective synthesis of tetracyclic intermediates en route to madangamine D
First enantioselective synthesis of tetracyclic intermediates en route to madangamine D Mercedes Amat,* Roberto Ballette, Stefano Proto, Maria Pérez, and Joan Bosch Laboratory of Organic Chemistry, Faculty
More informationNear IR Excitation of Heavy Atom Free Bodipy Photosensitizers Through the Intermediacy of Upconverting Nanoparticles
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Near IR Excitation of Heavy Atom Free Bodipy Photosensitizers Through the Intermediacy of Upconverting
More informationSupporting Information
Tandem Long Distance Chain-Walking/Cyclization via RuH 2 (CO)(PPh 3 ) 3 /Brønsted Acid Catalysis: Entry to Aromatic Oxazaheterocycles Rodrigo Bernárdez, Jaime Suárez, Martín Fañanás-Mastral, Jesús A. Varela
More informationEnantioselective total synthesis of fluvirucinin B 1
Enantioselective total synthesis of fluvirucinin B 1 Guillaume Guignard, Núria Llor, Elies Molins, Joan Bosch*, and Mercedes Amat* Laboratory of Organic Chemistry, Faculty of Pharmacy, and Institute of
More informationSupporting Information
Supporting Information Ruthenium-catalyzed Decarboxylative and Dehydrogenative Formation of Highly Substituted Pyridines from Alkene-tethered Isoxazol-5(4H)-ones Kazuhiro kamoto,* Kohei Sasakura, Takuya
More informationDesymmetrization of 2,4,5,6-Tetra-O-benzyl-D-myo-inositol for the Synthesis of Mycothiol
Desymmetrization of 2,4,5,6-Tetra--benzyl-D-myo-inositol for the Synthesis of Mycothiol Chuan-Chung Chung, Medel Manuel L. Zulueta, Laxmansingh T. Padiyar, and Shang-Cheng Hung* Genomics Research Center,
More informationStereoselective Synthesis of Tetracyclic Indolines via Gold-Catalyzed Cascade Cyclization Reactions
Stereoselective Synthesis of Tetracyclic Indolines via Gold-Catalyzed Cascade Cyclization Reactions Gianpiero Cera, Pasquale Crispino, Magda Monari, Marco Bandini* Dipartimento di Chimica Organica G. Ciamician,
More informationEugenol as a renewable feedstock for the production of polyfunctional alkenes via olefin cross-metathesis. Supplementary Data
Eugenol as a renewable feedstock for the production of polyfunctional alkenes via olefin cross-metathesis Hallouma Bilel, a,b Naceur Hamdi, a Fethi Zagrouba, a Cédric Fischmeister,* b Christian Bruneau*
More informationZn-mediated electrochemical allylation of aldehydes in aqueous ammonia
Zn-mediated electrochemical allylation of aldehydes in aqueous ammonia Jing-mei Huang,*,a,b Yi Dong a a School of Chemistry and Chemical Engineering, South China University of Technology, Guangzhou, Guangdong,
More informationSupporting Information. for. Z-Selective Synthesis of γ,δ-unsaturated Ketones via Pd-Catalyzed
Supporting Information for Z-Selective Synthesis of γ,δ-unsaturated Ketones via Pd-Catalyzed Ring Opening of 2-Alkylenecyclobutanones with Arylboronic Acids Yao Zhou, Changqing Rao, and Qiuling Song *,,
More informationStereoselective Synthesis of the CDE Ring System of Antitumor Saponin Scillascilloside E-1
Stereoselective Synthesis of the CDE Ring System of Antitumor Saponin Scillascilloside E-1 Yoshihiro Akahori, Hiroyuki Yamakoshi, Shunichi Hashimoto, and Seiichi Nakamura*, Graduate School of Pharmaceutical
More informationSynthesis of imidazolium-based ionic liquids with linear and. branched alkyl side chains
Supplementary Data Synthesis of imidazolium-based ionic liquids with linear and branched alkyl side chains Tina Erdmenger, 1,2 Jürgen Vitz, 1,2 Frank Wiesbrock, 1,2,# Ulrich S. Schubert 1,2,3 * 1 Laboratory
More informationExerting Control over the Acyloin Reaction
Supporting Information Exerting Control over the Acyloin Reaction Timothy J. Donohoe,* Ali. Jahanshahi, Michael J. Tucker, Farrah L. Bhatti, Ishmael A. Roslan, Mikhail A. Kabeshov and Gail Wrigley * Department
More informationSupporting Information. Small molecule inhibitors that discriminate between protein arginine N- methyltransferases PRMT1 and CARM1
Supporting Information Small molecule inhibitors that discriminate between protein arginine - methyltransferases PRMT1 and CARM1 James Dowden,* a Richard A. Pike, a Richard V. Parry, b Wei Hong, a Usama
More informationSupporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2019 Supporting Information for En-route to 3-Spiroindolizines Containing Isoindole
More informationSupplementary data. A Simple Cobalt Catalyst System for the Efficient and Regioselective Cyclotrimerisation of Alkynes
Supplementary data A Simple Cobalt Catalyst System for the Efficient and Regioselective Cyclotrimerisation of Alkynes Gerhard Hilt,* Thomas Vogler, Wilfried Hess, Fabrizio Galbiati Fachbereich Chemie,
More informationSupplementary Information. Catalytic reductive cleavage of methyl -D-glucoside acetals to ethers using hydrogen as a clean reductant
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 24 Supplementary Information Catalytic reductive cleavage of methyl -D-glucoside acetals to ethers
More informationSupporting information. for. Highly Stereoselective Synthesis of Primary, Secondary and Tertiary -S-Sialosides under Lewis Acidic Conditions
Supporting information for Highly Stereoselective Synthesis of Primary, Secondary and Tertiary -S-Sialosides under Lewis Acidic Conditions Amandine Noel, Bernard Delpech and David Crich * Centre de Recherche
More informationSupporting Information
Supporting Information A Convergent Synthesis of Enantiopure pen-chain, Cyclic and Fluorinated α-amino Acids Shi-Guang Li, Fernando Portela-Cubillo and Samir Z. Zard* Laboratoire de Synthése rganique,
More informationSUPPORTING INFORMATION
S1 SUPPRTING INFRMATIN Concise Total Synthesis of the Potent Translation and Cell Migration Inhibitor Lactimidomycin Kevin Micoine and Alois Fürstner* Max-Planck-Institut für Kohlenforschung, D-45470 Mülheim/Ruhr,
More informationFour-Component Reactions towards Fused Heterocyclic Rings
Four-Component Reactions towards Fused Heterocyclic Rings Etienne Airiau, a icolas Girard a, André Mann* a, Jessica Salvadori b, and Maurizio Taddei b [a] Faculté de Pharmacie, Université de Strasbourg
More informationBetti reaction enables efficient synthesis of 8-hydroxyquinoline inhibitors of 2-oxoglutarate. Contents Compound Characterisation...
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2015 Betti reaction enables efficient synthesis of 8-hydroxyquinoline inhibitors of 2-oxoglutarate
More informationStructure and reactivity in neutral organic electron donors derived from 4-dimethylaminopyridine
Supporting Information for Structure and reactivity in neutral organic electron donors derived from 4-dimethylaminopyridine Jean Garnier 1, Alan R. Kennedy 1, Leonard E. A. Berlouis 1, Andrew T. Turner
More informationSquaric acid: a valuable scaffold for developing antimalarials?
Squaric acid: a valuable scaffold for developing antimalarials? S. Praveen Kumar a, Paulo M. C. Glória a, Lídia M. Gonçalves a, Jiri Gut b, Philip J. Rosenthal b, Rui Moreira a and Maria M. M. Santos a,*
More informationTotal Synthesis of Sphingofungin F by Orthoamide-Type Overman Rearrangement of an Unsaturated Ester. Supporting Information
Total Synthesis of Sphingofungin F by Orthoamide-Type Overman Rearrangement of an Unsaturated Ester Shun Tsuzaki, Shunme Usui, Hiroki Oishi, Daichi Yasushima, Takahiro Fukuyasu, Takeshi Oishi Takaaki Sato,*
More informationSupporting Information
Supporting Information Visible-Light-Enhanced Ring-Opening of Cycloalkanols Enabled by Brønsted Base-Tethered Acyloxy Radical Induced Hydrogen Atom Transfer-Electron Transfer Rong Zhao,,, Yuan Yao,, Dan
More informationSmI 2 H 2 O-Mediated 5-exo/6-exo Lactone Radical Cyclisation Cascades
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 SmI 2 H 2 O-Mediated 5-exo/6-exo Lactone Radical Cyclisation Cascades Irem Yalavac, Sarah E. Lyons,
More informationPreparation of allylboronates by Pd-catalyzed borylative cyclization of dienynes
Preparation of allylboronates by Pd-catalyzed borylative cyclization of dienynes Ruth López-Durán, Alicia Martos-Redruejo, Elena uñuel, Virtudes Pardo- Rodríguez and Diego J. Cárdenas* Departamento de
More informationSupporting Information
Supporting Information Palladium-catalyzed Tandem Reaction of Three Aryl Iodides Involving Triple C-H Activation Xiai Luo, a,b Yankun Xu, a Genhua Xiao, a Wenjuan Liu, a Cheng Qian, a Guobo Deng, a Jianxin
More informationPhosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans
Supplementary Note Phosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans Sebastian Boland, Ulrike Schmidt, Vyacheslav Zagoriy, Julio L. Sampaio, Raphael Fritsche, Regina
More informationDiscovery of antagonists of PqsR, a key player in 2-alkyl-4-quinolone-dependent quorum sensing in Pseudomonas aeruginosa.
Discovery of antagonists of PqsR, a key player in 2-alkyl-4-quinolone-dependent quorum sensing in Pseudomonas aeruginosa. Item Type Article Authors Lu, Cenbin; Kirsch, Benjamin; Zimmer, Christina; de Jong,
More informationSupporting Information
S1 Supporting Information Convergent Stereoselective Synthesis of the Visual Pigment A2E Cristina Sicre, M. Magdalena Cid* Departamento de Química Orgánica, Universidade de Vigo, Campus Lagoas-Marcosende,
More informationOne-Pot Synthesis of Symmetric 1,7-Dicarbonyl Compounds Via. a Tandem Radical Addition - Elimination Addition Reaction
S1 One-Pot Synthesis of Symmetric 1,7-Dicarbonyl Compounds Via a Tandem Radical Addition - Elimination Addition Reaction Zhongyan Huang and Jiaxi Xu* State Key Laboratory of Chemical Resource Engineering,
More informationO of both receptor subtypes. ERα is predominantly involved in the
Journal Name Dynamic Article Links Cite this: DI:.39/c0xx00000x www.rsc.org/xxxxxx ARTICLE TYPE Towards β-selectivity in Functional Estrogen Receptor Antagonists Jose Juan Rodríguez, a Kamila Filipiak,
More informationOrganic & Biomolecular Chemistry
Organic & Biomolecular Chemistry PAPER Cite this: Org. Biomol. Chem., 2013, 11, 6176 Received 21st June 2013, Accepted 22nd July 2013 DOI: 10.1039/c3ob41290c www.rsc.org/obc Introduction During the last
More informationSynthesis of diospongin A, ent-diospongin A and C-5 epimer of diospongin B from tri-o-acetyl-d-glucal
General Papers ARKIVC 2015 (vii) 195-215 Synthesis of diospongin A, ent-diospongin A and C-5 epimer of diospongin B from tri--acetyl-d-glucal Andrea Zúñiga, a Manuel Pérez, a Zoila Gándara, a Alioune Fall,
More informationElectronic supplementary information for Light-MPEG-assisted organic synthesis
Electronic supplementary information for Light-MPEG-assisted organic synthesis Marek Figlus, Albert C. Tarruella, Anastasia Messer, Steven L. Sollis, Richard C. Hartley WestCHEM Department of Chemistry,
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Pyridazinediones deliver potent, stable, targeted and
More informationElectronic Supplementary Information for
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information for Synthesis of polycyclic spiroindolines by highly diastereo-selective
More informationElectronic Supporting Information. Optimisation of a lithium magnesiate for use in the noncryogenic asymmetric deprotonation of prochiral ketones
Electronic Supporting Information Optimisation of a lithium magnesiate for use in the noncryogenic asymmetric deprotonation of prochiral ketones Javier Francos, Silvia Zaragoza-Calero and Charles T. O
More informationThis article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution
More informationDiborane Heterolysis: Breaking and Making B-B bonds at Magnesium
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2018 Supplementary Information for Diborane Heterolysis: Breaking and Making B-B bonds at
More informationEnantioselective Synthesis of Cyclopropylcarboxamides using s- BuLi/Sparteine-Mediated Metallation
Electronic Supplementary Information Enantioselective Synthesis of Cyclopropylcarboxamides using s- BuLi/Sparteine-Mediated Metallation Stephanie Lauru, a Nigel S. Simpkins,* a,b David Gethin, c and Claire
More informationPyridine Activation via Copper(I)-Catalyzed Annulation toward. Indolizines
Supporting Information for: Pyridine Activation via Copper(I)-Catalyzed Annulation toward Indolizines José Barluenga,* Giacomo Lonzi, Lorena Riesgo, Luis A. López, and Miguel Tomás* Instituto Universitario
More informationSupporting Information
Natural product-derived Transient Receptor Potential Melastatin (TRPM8) channel modulators Christina M. LeGay, a Evgueni Gorobets, a Mircea Iftinca, b Rithwik Ramachandran, c Christophe Altier, b and Darren
More informationRegio- and Stereoselective Aminopentadienylation of Carbonyl Compounds. Orgánica (ISO), Universidad de Alicante, Apdo. 99, Alicante, Spain.
Regio- and Stereoselective Aminopentadienylation of Carbonyl Compounds Irene Bosque, a Emine Bagdatli, b Francisco Foubelo, a and Jose C. Gonzalez-Gomez*,a a Departamento de Química Orgánica, Facultad
More informationSynthesis and Antiviral Evaluation of 6-(Trifluoromethylbenzyl)
I:/3B2/Jobs/archiv/2007/Heft11/1.3d 22. 10. 2007 Arch. Pharm. Chem. Life Sci. 2007, 340, 0000 0000 N. R. El-Brollowsy et al. 1 Full Paper Synthesis and Antiviral Evaluation of 6-(Trifluoromethylbenzyl)
More information1 PROTOCOL FOR FLUORESCENCE IMAGING SYSTEM. General Switch (1), (2) DG4 Lamp switch (3) DG4 Main Switch (4) LAMBDA 10-2 (5) Camera (6) Computer (7)
1 PROTOCOL FOR FLUORESCENCE IMAGING SYSTEM Microscope and Software Setup: General Switch (1), (2) DG4 Lamp switch (3) DG4 Main Switch (4) LAMBDA 10-2 (5) Camera (6) Computer (7) heating system general
More information5. Drain off excess 1X PBS (gently blot PBS off underside of coverslip after draining) and transfer slides/coverslips to humid chamber.
IMMUNOFLUORESCENCE: SINGLE AND DUAL LABELING WITH MONOCLONAL PRIMARY ANTIBODIES (INDIRECT METHOD) See Developmental Dynamics 206:24-38, 1996 1. Fix sections/coverslips in 3% paraformaldehyde as directed
More informationInstructions for Authors. Updated according to the new regulations in the publication policy of Romanian Biotechnological Letters.
Instructions for Authors Updated according to the new regulations in the publication policy of Romanian Biotechnological Letters. The journal (ISSN 1224-5984) publishes papers on biotechnology, applied
More informationSupporting Information
Supporting Information Wiley-VCH 2005 69451 Weinheim, Germany Supporting Information Design of a Mechanism-Based Probe for Neuraminidase to Capture Influenza Viruses Chun-Ping Lu, c, Chien-Tai Ren, a,
More informationSynthesis of an Advanced Intermediate of the Jatrophane Diterpene Pl 4: A Dibromide Coupling Approach
pubs.acs.org/joc Synthesis of an Advanced Intermediate of the Jatrophane Diterpene Pl 4: A Dibromide Coupling Approach Rita Fu rst and Uwe Rinner* Institute of Organic Chemistry, University of Vienna,
More informationRIDA GENE Color Compensation Kit I
RIDA GENE Color Compensation Kit I Art. No.: PG0001 3 reactions -20 C R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Germany Tel.: +49 (0) 61 51 81 02-0 / Telefax: +49 (0) 61 51 81 02-20
More informationBodipy-VAD-Fmk, a useful tool to study Yeast Peptide N- Glycanase activity
Bodipy-VAD-Fmk, a useful tool to study Yeast Peptide N- Glycanase activity Martin D. Witte, Carlos V. Descals, Sebastiaan V. P. de Lavoir, Bogdan I. Florea, Gijsbert A. van der Marel * and Herman S. verkleeft
More informationGeneral Synthesis of Alkenyl Sulfides by Palladium-Catalyzed Thioetherification of Alkenyl Halides and Tosylates
General Synthesis of Alkenyl Sulfides by Palladium-Catalyzed Thioetherification of Alkenyl Halides and Tosylates Noelia Velasco, Cintia Virumbrales, Roberto Sanz, Samuel Suárez-Pantiga* and Manuel A. Fernández-
More informationLEGEND MAX Human α-synuclein ELISA Kit with Pre-coated Plate Catalog No.: (Previously Covance Cat. No. SIG-38974)
Human α-synuclein ELISA Kit Components and Protocol Kit Components Capture Antibody Coated Plate* 1 plate a-synuclein Standard (1) 25μg vial 5X Wash Buffer 250mL 2X Reagent Diluent 32mL Biotinylated Primary
More informationChapter 3. Towards the understanding of structural factors inducing cell transfection properties in arginino-calix[4]arenes
Chapter 3 Towards the understanding of structural factors inducing cell transfection properties in arginino-calix[4]arenes 3.1 Introduction The results discussed in Chapter 2 indicated that compound 3
More informationmanually. Page 18 paragraph 1 sentence 2 have was added between approaches and been.
List of corrections from examiner 1 All the typo and grammatical errors indicated in the copy of the thesis as suggested by examiner 1 were corrected. Page vi word chromatography was added in the abbreviation
More informationSupporting information for. Modulation of ICT probability in bi(polyarene)-based. O-BODIPYs: Towards the development of low-cost bright
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2017 Supporting information for Modulation of ICT probability in bi(polyarene)based BDIPYs:
More informationThe RNA binding protein HuR determines the differential translation of autismassociated. FoxP subfamily members in the developing neocortex
The RNA binding protein HuR determines the differential translation of autismassociated FoxP subfamily members in the developing neocortex Popovitchenko T 1, Thompson K 1, Viljetic B 1, Jiao X 2, Kontonyiannis
More informationExploring of drug leads from diversity-oriented Michael-acceptor library derived from natural products
Regular Article Nat. Prod. Bioprospect. 2012, 2, 210 216 DOI 10.1007/s13659-012-0071-7 Exploring of drug leads from diversity-oriented Michael-acceptor library derived from natural products Xu DENG, a,b
More informationIMPORTANT MANUSCRIPT SUBMISSION REQUIREMENTS
JOC The Journal of Organic Chemistry Guidelines for Authors Updated January 2017 IMPORTANT MANUSCRIPT SUBMISSION REQUIREMENTS Notes and JOCSynopses are limited to 3000 and 4000 words, respectively; tables
More informationSECTOR Imager Performance Qualification Kit
SECTOR Imager Performance Qualification Kit R31QQ-3 18114-v2-2014Feb 1 MESO SCALE DISCOVERY SECTOR Imager Performance Qualification Kit For use with SECTOR Imager 6000, SECTOR Imager 2400, SECTOR Imager
More informationNew Guanidinium-based Room-temperature Ionic Liquids. Substituent and Anion Effect on Density and Solubility in Water
New Guanidinium-based Room-temperature Ionic Liquids. Substituent and Anion Effect on Density and Solubility in Water Milen G. Bogdanov a,c, Desislava Petkova a,c, Stanimira Hristeva a,c, Ivan Svinyarov
More informationUniversity of Groningen
University of Groningen Tuning the leaving group in 2-deoxy-2-fluoroglucoside results in improved activity-based retaining β-glucosidase probes Walvoort, Marthe T.C.; Kallemeijn, Wouter W.; Willems, Lianne
More informationFriedel-Crafts hydroxyalkylation through activation of carbonyl group using AlBr 3 : An easy access to pyridyl aryl / heteroaryl carbinols
Electronic Supplementary Information Friedel-Crafts hydroxyalkylation through activation of carbonyl group using AlBr 3 : An easy access to pyridyl aryl / heteroaryl carbinols Adhikesavan Hari Krishnan,
More informationProtocol for a Cell Proliferation Assay Using the µ-slide Angiogenesis
Protocol for a Cell Proliferation Assay Using the µ-slide Angiogenesis 1. General Information... 1 2. Background... 1 3. Material and Equipment Needed... 2 4. Experimental Procedure... 2 a. Seeding Cells...
More informationSite Specific Protein Immobilization Into Structured Polymer Brushes Prepared by AFM Lithography
Supporting Information for Site Specific Protein Immobilization Into Structured Polymer Brushes Prepared by AFM Lithography Hendrik Wagner, + Yong Li, + Michael Hirtz, Lifeng Chi,* Harald Fuchs, Armido
More information