Small Molecule Modulation of Wnt Signaling via Modulating the Axin-LRP5/6 Interaction Sheng Wang 1#, Junlin Yin 2#, Duozhi Chen 2, Fen Nie 1, Xiaomin Song 1, Cong Fei 1, Haofei Miao 1, Changbin Jing 3, Wenjing Ma 3, Lei Wang 2, Sichun Xie 1, Chen Li 4, Rong Zeng 4, Weijun Pan 3, Xiaojiang Hao 2 * and Lin Li 1 * 1 State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 2 State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650204, China 3 Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences & Shanghai Jiao Tong University School of Medicine, Shanghai 200025, China. 4 Key Laboratory of Systems Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China # These authors contributed equally to this work. * Correspondence: Lin Li, E-mail: lli@sibs.ac.cn; and Xiaojiang Hao, E-mail: haoxj@mail.kib.ac.cn.
Supplementary Table 1: Primers used for real-time quantitative PCR assays Genes Forward primers (5-3 ) Reverse primers (5-3 ) AXIN2(Homo sapiens) DKK1 (Homo sapiens) NKD1 (Homo sapiens) GAPDH (Homo sapiens) cdx4 (Danio rerio) tbx6 (Danio rerio) ntl(danio rerio) runnx1 (Danio rerio) cmyb (Danio rerio) AGGCTAGCTGAGGTGT CTGCAAAAATGGAATATGTGT GTCAACCACTCCCCAACATC AGGTCGGAGTCAACGGATTTG CTCCGGGACCAGTTTCCTAT CAAGCTGGATTTGACTGCAA GAAAGTCGGTGGGATTCAGA CGTCTTCACAAACCCTCCTCAA GAACGGCTACGGTGGCTGG AGGCTTGGATTGGAGAA CTTCTTGTCCTTTGGTGTGA AATGGTGGTAGCAGCCAGAC TGTAAACCATGTAGTTGAGGTCA CTCCTTCGTTCTCGTTTTGC GGGGTTTGTGAAGGCTGATA TCTGGGACTTCCTTGTGGTC GCTTTACTGCTTCATCCGGCT CGTTATTTGGGCTGTTTGTGTTGC gapdh (Danio rerio) CAGGCATAATGGTTAAAGTTGGTA CATGTAATCAAGGTCAATGAATGG
Supplementary Table 2: Primers used for Axin mutation constructs Mutants Primers R765A Forward primers (F), Reverse primers (R) CACCCTGGTGGCGGGCCGCGCTGTCAC GTGACAGCGCGGCCCGCCACCAGGGTG E776A GCCAGTTCAAGGCGCTGCTGACCAAA TTTGGTCAGCAGCGCCTTGAACTGGC K780S GCTGCTGACCAGTAAGGGCAGCTACAG CTGTAGCTGCCCTTACTGGTCAGCAGC V810R GAGGACGAGGCCCGCCTGCCCGTCTTTG CAAAGACGGGCAGGCGGGCCTCGTCCTC resistant to Axin sirna CTGAAGCTGGCAAGAGCAATCTACAGGAAGTACATTC GAATGTACTTCCTGTAGATTGCTCTTGCCAGCTTCAG Supplementary Table 3: sirna sequences for the targeted genes as indicated Knockdown constructs Target sequences (5-3 ) Si-Axin Si-Axin2 NC ( negative control) CGAGAGCCAUCUACCGAAATT AGACGAUACUGGACGAUCATT UUCUCCGAACGUGUCACGUTT
Supplementary Table 4: Small molecule screening data Category Parameter Description Assay Type of assay Cell-based Target Primary measurement Key reagents Wnt/β-catenin signaling pathway Detection of Firefly luciferase enzyme activities and GFP expression TOPFlash (Millipore) and Luciferase Assay (Roche) Assay protocol HEK293T cells were seeded in 48-well plates. Each well of HEK293T cells was transfected with 125 ng of plasmids in total, including 10 ng of TOPFlash and 115 ng of LacZ plasmid. 18 hrs later, cells were treated for 1 hr with small molecule (10 µm) followed by control conditioned medium (CM) or Wnt3a CM plus the same dose of small molecule for additional 6 hrs before luciferase activity assays. The luciferase enzyme activities were determined for Wnt signaling activity; And, GFP expression levels were determined for normalization. Additional comments The postive small molecule only impacted luciferase enzyme activities and did not impact GFP expression levels. Library Library size approximately 200 Library composition Source Additional comments synthetic chemical compounds Screen Format 48-well, Corning 3548 Concentration(s) tested Plate controls Reagent/ compound dispensing system Detection instrument and software Assay validation/qc Correction factors Normalization Additional comments State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany, Chinese Academy of Sciences no 10 µm, 1% DMSO NC043 Manual Synergy 2 (BioTek) NC043 inhibits Wnt signaling. no luciferase enzyme activities were normalized by GFP expression levels. no Post-HTS analysis Hit criteria TOPFlash Fluc/GFP ratio > 2 standard deviations from the mean; or TOPFlash Fluc/GFP ratio < 0.5 standard deviations from the mean Hit rate Approximately 0.5% Additional assay(s) Confirmation of hit purity and structure Additional comments FOPflash reporter assay in HEK 293 Cells. TOPflash Wnt signaling reporter assay with LiCl in HEK 293 Cells, and immunoblotting for intra-cellular levels of the cytosolic and nuclear β-catenin. Compounds were verified analytically. no
Supplementary References 1 Wang, W., Liu, H., Wang, S., Hao, X. & Li, L. A diterpenoid derivative 15-oxospiramilactone inhibits Wnt/beta-catenin signaling and colon cancer cell tumorigenesis. Cell Research 21, 730-40 (2011).
Supplementary Notes Synthesis and information of HLY78 and its analogs. 5-methyl-4-vinyl-5,6-dihydro-[1,3]dioxolo[4,5-j]phenanthridine (HLY72) -- The solution of (+)-lycorine (300 mg, 1 mmol) in DMF (10 ml) was put into a round-bottomed flask, following the CH 3 I (400 μl, 2 mmol) and stirred at room temperature for 12 hrs. The reaction solution was evaporated to remove DMF and then was charged with potassium tert-butoxide (PTB, 1.1 g, 10 mmol) and T-BuOH (TBA, 10 ml). The mixture was heated to 90 C and stirred for 4 hrs. The mixture was diluted in 50 ml saturated NH 4 Cl and Then with EtO 2 (20 ml) for twice and the organic phase was washed with saturated NH 4 Cl, brine, dried over MgSO 4, filtered, and concentrated. The residue was purified by column chromatography with petroleum ether-etoac (5:1) to give HLY72 as pale yellow solid (240 mg, yield 90%). mp: 168-170 C ; 1 H NMR (400 MHz, CDCl 3 ): δ 7.58 (d, J = 7.7 Hz, 1H), 7.47 (d, J = 7.7 Hz, 1H), 7.26 (dt, J = 10.7, 7.1 Hz, 2H), 7.16 (t, J = 7.7 Hz, 1H), 6.72 (s, 1H), 5.99 (s, 2H), 5.75 (d, J = 17.8 Hz, 1H), 5.32 (d, J = 11.1 Hz, 1H), 4.03 (s, 2H), 2.51 (s, 3H); 13 C NMR (100 MHz, CDCl 3 ) : δ147.4 (C), 145.1 (C), 133.4 (CH), 133.2 (C), 129.2 (C), 126.4 (C), 125.8 (C), 124.9 (CH), 124.3 (CH), 122.7 (CH), 114.3 (CH 2 ), 107.1 (CH), 103.6 (CH), 100.9 (CH 2 ), 54.8 (CH 2 ), 41.5 (CH), ESI + MS (m/z): 266 [M+H] +. 4-ethyl-5-methyl-5,6-dihydro-[1,3]dioxolo[4,5-j]phenanthridine (HLY78) -- HLY72 (27 mg, 0.1 mmol) and TsNHNH 2 was dissolved in THF/H 2 O (5 ml, 4:1) and the solution was heated to refulx for 4 h then the mixture was cooled down and charged with NaOAc (73.8 mg, 0.3 mmol) followed with NH 4 Cl (10 ml, 2 M). The solution was extracted with Et 2 O (30 ml) for twice. The organic layer was washed with brine, dried over MgSO 4, filtered, and concentrated. The residue was purified by column chromatography with petroleum ether-etoac (20:1) as eluent to afford HLY78 as a solid (25 mg, yield 95%). mp: 159-160 C ; 1 H NMR (400 MHz, MeOD) : δ7.51 (t, J = 8.4 Hz, 1H), 7.28 (d, J = 6.4 Hz, 2H), 7.20 (t, J = 7.9 Hz, 2H), 6.75 (s,
1H), 6.01 (s, 1H), 4.01 (s, 2H), 2.83 (q, J = 7.5 Hz, 2H), 2.50 (s, 3H), 1.32 (dd, J = 15.7, 8.2 Hz, 3H); 13 C NMR (100 MHz, CDCl 3 ) : δ147.3 (C), 147.1 (C), 145.4 (C), 139.4 (C), 129.3 (C), 127.7 (CH), 126.6 (C), 126.3 (C), 124.6 (CH), 121.0 (CH), 107.2 (CH), 103.7 (CH), 100.9 (CH 2 ), 55.2 (CH 2 ), 41.02 (CH), 23.1 (CH 2 ), 14.8 (CH 3 ), HREIMS (m/z): [M] + calcd for C 17 H 17 NO 2, 267.1259; found, 267.1261. 4-ethyl-5-methyl-5,6-dihydrophenanthridine-8,9-diol (HLY119) -- A dry round-bottomed flask was charged with HLY78 (55 mg, 0.2 mmol) and CH 2 Cl 2 (10 ml). The reactor was then cooled to -78 C and BBr 3 (200 μl, 0.4 mmol) was added. The mixture was stirred for 6 h and diluted in 50 ml saturated NaHCO 3. It was extracted with CH 2 Cl 2 (20 ml) for twice. The organic layer was washed with brine and concentrated. The residue was purified by column chromatography with chloroform-methanol (20:1) as eluent to give 5 as a pale yellow solid (35.7 mg, yield 70%). 1 H NMR (400 MHz, CDCl 3 ) : δ7.46 (d, J = 7.1 Hz, 1H), 7.27 (d, J = 2.7 Hz, 1H), 7.17-7.11 (m, 2H), 6.75 (s, 1H), 3.96 (s, 2H), 2.79 (q, J = 7.5 Hz,2H), 2.47 (s, 3H), 1.28 (dd, J = 14.7, 7.1 Hz, 3H); 13 C NMR (100 MHz, CDCl 3 ) : δ143.8 (C), 143.0 (C), 139.4 (C), 129.0 (C), 127.6 (CH), 125.7 (C), 125.5 (C), 124.7 (CH), 120.9 (CH), 113.8 (CH), 113.4 (C), 110.4 (CH), 54.6 (CH 2 ), 41.2 (CH 3 ), 23.1 (CH 2 ), 14.8 (CH 3 ); ESI + MS (m/z): 256 [M+H] +. 5,6-Dihydrobicolorine (Hss49a) -- This compound is a alkaloid which was isolated from lycoris rasiata. 1 H NMR (CDCl 3, 400 MHz) : δ7.30 (m, 1H,), 7.02 (s, 1H, H-7), 7.01 (m, 1H,), 6.85 (m, 1H), 6.76 (m, 1H), 6.69 (s, 1H, H-10), 6.01 (s, 2H,,-OCH 2 O-), 4.28-4.19 (m, 2H, H-6); 13 C NMR (CDCl 3, 400 MHz) : δ147.6, (C) 147.5 (C), 146.6 (C), 133.9 (C), 131.1 (C), 129.9 (CH), 129.0 (CH), 118.1 (CH), 111.0 (CH), 110.9 (C), 110.2 (CH), 109.9 (CH), 101.3 (CH 2, -OCH 2 O-), 63.8 (CH 2 ), 30.8 (CH 3 ); ESI + MS (m/z): 258 [M+H] +. 5,7-dihydro-4H-[1,3]dioxolo[4,5-j]pyrrolo[3,2,1-de]phenanthridine (HLY103) -- Lycorine (28.7mg, 0.1mmol) was dissolved in DMF (2 ml) then added Burgess regant (47.6mg, 0.2mmol). The mixture was strried at 50 C for 2 hrs under N 2 then concentrated in vacuo, and the residue was purified by column chromatography with
petroleum ether-etoac (100:1) to give HLY103 as a colorless solid (17.5mg, 70%). 1 H NMR (400 MHz, CDCl 3 ) : δ7.27 (t, J = 5.5 Hz, 1H), 7.18 (d, J = 9.8 Hz, 1H,), 7.01 (d, J = 7.3 Hz, 1H), 6.77 (t, J = 7.5 Hz, 1H), 6.63 ( s, 1H), 5.96 (s, 2H), 4.06 (s, 2H), 3.32 (t, J = 7.9 Hz, 2H), 3.02 (t, J = 8.0 Hz, 2H); 13 C NMR (100 MHz, CDCl 3 ) : δ149.5 (C), 147.4 (C), 146.4 (C), 128.8 (C), 128.4 (C), 126.0 (C), 123.4 (C), 123.1 (CH), 119.6 (CH), 119.5 (CH), 119.3 (CH), 107.4 (CH), 101.0 (CH 2 ), 55.4 (CH 2 ), 53.5 (CH 2 ), 29.0 (CH 2 ); ESI - MS (m/z): 250 [M-H] -. Synthesis and information of HLY179 and its intermediates. 4-ethyl-5-methyl-8,9-bis(prop-2-tri-azole-ethylamineoxy)-5,6-dihydrophenan thridine (HLYC60) -- To HLYC175 (9) (22 ml, 0.25 mmol) in H 2 O/tBuOH (2mL, 1:1) was added HLY165a (66.0 mg, 0.2 mmol), followed by CuSO 4 (3.0 mg) and sodium ascorbate solution (50 μl, 1 M solution). The solution was stirred for 15 hrs at r.t. then was concentrated in vacuo, and the residue was purified by column chromatography with chloroform-methanol (9:1) to give HLYC60 as a waxy stuff (60 mg, 55%). 1 H NMR (400 MHz, CDCl 3 ) : δ7.78 (m, 1H), 7.51-7.41 (m, 3H), 7.15-7.08 (m, 3H), 5.23-5.16 (m, 8H), 4.52-4.43 (m, 2H), 4.42 (s, 1H), 3.50 (s, 2H), 3.45 (s, 2H), 2.78 (d, J = 8 Hz, 2H), 2.44 (s, 3H), 1.27 (t, J = 8.0 Hz, 3H); 13 C NMR (150 MHz, CDCl 3 ) : δ147.17 (C), 144.05 (C), 139.44 (C), 135.99 (C), 134.83 (CH), 134.03 (C), 128.80 (C), 128.44 (C), 124.75 (CH), 124.51 (CH), 121.62 (CH), 121.55 (CH), 115.64 (C), 115.55 (C), 110.23 (CH), 109.84 (CH), 64.27 (CH 2 ), 63.26 (CH 2 ), 54.96 (CH 2 ), 50.78 (CH 2 ), 50.61 (CH 2 ), 41.65 (CH 3 ), 40.29 (CH 2 ), 39.41 (CH 2 ), 29.91 (CH 2 ), 15.27 (CH 3 ); HREIMS (m/z): [M] + calcd for C 26 H 33 N 9 O 2, 503.2757; found, 503.2741. (R,S,S)-N,N'-(2,2'-(4,4'-(4-ethyl-5-methyl-5,6-dihydrophenanthridine-8,9-diyl )bis(oxy)bis(methylene)bis(1h-1,2,3-triazole-4,1-diyl))bis(ethane-2,1-diyl))bis(5-(( 3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide) (HLY179) -- To HLYC177 (68.6 mg, 0.22 mmol) in H 2 O/tBuOH (2 ml, 1:1) was added HLY165a (10) (33.1 mg, 0.1 mmol), followed by CuSO 4 (1.8 mg) and sodium ascorbate solution (30 μl, 1 M solution). The solution was stirred for 12 hrs at 50 C.
then was concentrated in vacuo, and the residue was purified by column chromatography with chloroform-methanol (9:1) to give HLY179 as a colorless solid (57.3 mg, 60%). mp: 196-197 C ; 1 H NMR (400 MHz, MeOD) : δ7.96 (s, 1H), 7.95 (s, 1H), 7.58-7.51 (m, 1H), 7.46 (s, 1H), 7.19-7.11 (m, 2H), 6.97 (s, 1H), 5.24 (s, 2H), 5.21 (s, 2H), 4.55-4.48 (m, 6H), 4.46-4.39 (m, 2H), 4.31-4.22 (m, 2H), 4.02-3.94 (m, 2H), 3.71-3.62 (m, 4H), 3.35-3.26 (m, 4H), 2.80-2.72 (m, 2H), 2.43 (s, 3H), 2.20-2.04 (m, 4H), 1.75-1.46 (m, 8H), 1.39-1.32 (m, 4H), 1.28 (t, J = 7.1 Hz, 3H); 13 C NMR (100 MHz, CDCl 3 ) : δ176.42, 170.23, 165.98, 163.95, 153.09, 152.51, 152.04, 149.87, 149.69, 147.94, 147.35, 147.29, 144.84, 143.41, 143.20, 142.15, 138.90, 128.20, 127.50, 126.39, 126.01, 125.20, 124.26, 123.96, 120.57, 119.87, 110.56, 108.66, 92.87, 89.43, 62.94, 62.41, 61.37, 59.65, 55.06, 54.05, 41.63, 40.49, 39.58, 38.68, 34.89, 27.76, 27.51, 24.85, 22.55, 14.04, 10.24; HREIMS (m/z): [M] + calcd for C 46 H 61 N 13 O 6 S 2, 955.4307; found, 955.4321. 4-ethyl-5-methyl-8,9-bis(prop-2-ynyloxy)-5,6-dihydrophenanthridine (HLY165a) -- HLY119 (26 mg, 0.1 mmol) dissolved in dry THF (3 ml), following added NaH (10 mg, 0.4 mmol) and propargyl bromide (20 μl, 0.25mmol). The mixture was stirred at room temperature for 24 hrs and then quenched by water (50 ml) in an ice bath. The reaction solution was evaporated to remove THF and extracted with CH 2 Cl 2 (30 ml) for twice. The organic layer was washed with saturated NaHCO 3, brine, dried over MgSO 4, filtered, and concentrated. The residue was purified by column chromatography with petroleum ether-etoac (9:1) as eluent to afford HLY165a as a solid (26.5 mg, yield 80%). 1 H NMR (400 MHz, CDCl 3 ) : δ 1 H NMR (400 MHz, CDCl 3 ) δ: 7.54 (d, J = 6.9 Hz, 1H), 7.46 (s, 1H), 7.23-7.12 (m, 2H), 6.91 (s, 1H), 4.83 (s, 2H), 4.80 (s, 2H), 4.02 (s, 2H), 3.09-2.99 (m, 2H), 2.86-2.74 (m, 2H), 2.47 (s, 3H), 1.29-1.17 (m, 3H); 13 C NMR (100 MHz, CDCl 3 ) δ: 147.4 (C), 146.8 (C), 145.6 (C), 139.5 (C), 128.9 (C), 127.9 (CH), 126.8 (C), 126.3 (C), 124.6 (CH), 121.0 (CH), 113.1 (CH), 110.5 (CH), 78.6 (C), 78.4 (C), 75.9 (CH), 75.8 (CH), 57.2 (CH 2 ), 56.9 (CH 2 ), 54.8 (CH 2 ), 41.31 (CH 3 ), 23.1 (CH 2 ), 14.8 (CH 3 ); ESI - MS (m/z): 330[M-H] -.
2,5-dioxopyrrolidin-1-yl-5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]i midazol-4-yl)pentanoate (HLYC176 (11)) -- A solution of D-biotin (24 mg, 0.1 mmol) in DMF (10 ml) was added with pyridine (2 ml) and DCC (41 mg, 0.2 mmol). The mixture was stirred for 0.5 h and then charged with N-Hydroxusuccinimide (13.8 mg, 0.12 mmol). The solution was stirred for 24 hrs at r.t. then was concentrated in vacuo, and the residue recrystallized from propanol to give HLYC176 as a colorless solid (22 mg, 65%). mp: 204-206 C ; 1 H NMR (400 MHz, [D6]DMSO) : δ6.42 (s, 1 H, 3-NH), 6.36 (s, 1 H, 1-NH), 4.27-4.32 (m, 1 H, 6a-H), 4.11-4.16 (m, 1 H, 3a-H), 3.06-3.12 (m, 1 H, SCH), 2.78-2.85 (m, 5 H, CH 2 CH 2 (succinyl), SCH 2 ), 2.66 (t, J = 7.3 Hz, 2 H, 2'-H), 2.57 (d, J = 11.4 Hz, 1 H, SCH 2 ), 1.58-1.68 (m, 3 H, 3'-H, 5'H), 1.35-1.54 (m, 3 H, 4'-H, 5'-H); 13 C NMR (100 MHz, [D6]DMSO) : δ170.3 (N(CO) 2 ), 168.9 (CO 2 ), 162.7 ((HN) 2 CO), 61.0 (C-3a), 59.2 (C-6a), 55.2 (SCH), 39.9 (SCH 2 ), 30.0 (C-2'), 27.8 (C-4'), 27.6 (C-5'), 25.4(CH 2 CH 2 (succinyl)), 24.3 (C-3'); ESI + MS (m/z): 342[M+H] +. N-(2-azidoethyl)-5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol- 4-yl)pentanamide (HLYC177) -- HLYC176 (34 mg, 0.1 mmol) and HLYC175 (17 mg 0.2 mmol) was dissolved in DMF (2 ml) and then Et 3 N (12 mg, 1.2 mmol) was added. The solution was stirred for 24 hrs at r.t. then was concentrated in vacuo, and the residue was purified by column chromatography with chloroform-methanol (20:1) to give HLYC177 as a colorless waxy stuff (23 mg, 70%). 1 H NMR (400 MHz, [D6]DMSO) δ: 8.03 (t, J = 5.3 Hz, 1 H,CONH), 6.42 (s, 1 H, 3-NH), 6.35 (s, 1 H, 1-NH), 4.26-4.32 (m, 1 H, 6a-H), 4.08-4.14 (m, 1 H, 3a-H), 3.31 (d, J = 7.6 Hz, 2 H, CH 2 N 3 ), 3.19-3.24 (m, 2H, CH 2 CH 2 N 3 ), 3.05-3.11 (m, 1H, SCH), 2.80 (dd, J = 12.4, 5.1 Hz, 1 H, SCH 2 ), 2.56 (d, J = 12.9 Hz, 1H, SCH 2 ), 2.06 (t, J = 7.3 Hz, 2H, 2'-H), 1.55-1.65 (m, 1H, 5'-H), 1.39-1.55 (m, 3H, 3'-H, 5'-H),1.20-1.38 (m, 2H, 4'-H); 13 C NMR (100 MHz, [D6]DMSO) δ: 172.4 (CONH), 162.7 ((HN) 2 CO), 61.0 (C-3a), 59.2 (C-6a), 55.4 (SCH), 50.0 (CH 2 N 3 ), 39.9 (SCH 2 ), 38.1 (CH 2 CH 2 N 3 ), 35.1 (C-2'), 28.2 (C-4'), 28.0 (C-5'), 25.2 (C-3'); HRESI + MS (m/z): [M+H] + calcd for C 12 H 20 N 6 O 2 S + H, 313.14412; found, 313.14419.
2-Azidoethylamine (HLYC175) -- 2-Bromoethylamine hydrobromide (500 mg, 2.44 mmol) and sodium azide (475.9 mg, 7.32 mmol) was dissolved in H 2 O (2 ml), The mixture was heated to 75 C and stirred for 21 hrs then was cooled down to 0 C. KOH (800 mg) and Et 2 O (2 ml) was added, the solution was extracted with Et 2 O (2 10 ml), then concentrated in vacuo, and the residue was purified by column chromatography with chloroform-methanol (20:1) to give HLYC175 as a colorless liquid (171 mg, 82%). 1 H NMR (400 MHz, CDCl 3 ) : δ3.30 (t, J = 5.7 Hz, 2 H, CH 2 NH 2 ), 2.80-2.84 (m, 2 H, CH 2 N 3 ), 1.27 (s, 2 H, NH 2 ); 13 C NMR (100 MHz, CDCl 3 ) δ: 54.6 (CH 2 N 3 ), 41.2 (CH 2 NH 2 ); ESI + MS (m/z): 87 [M+H] +.
Supplementary Chemical Compound Information HLY72 1
HLY78 2
HLY119 3
HSS49a 4
HLY179: 5
HLYC60 6