De-multiplexing & Quality Control Challenges and Solutions. Sridhar Srinivasan Bioinformatician Premas Lifescience

Transcription

1 De-multiplexing & Quality Control Challenges and Solutions Sridhar Srinivasan Bioinformatician Premas Lifescience

2 Abstract Illumina has multiple sequencing platforms that produces large amount of high quality sequence data in a short time frame. To utilize full potential of a sequencing run, we generally multiplex many samples in to a run. This has to be followed by demultiplexing and quality control of data to get reliable and reproducible results.

3 Our Discussion Here Is About The tools and strategies to get good demultiplexed data. Also includes how to check various quality parameters of sequencing data and methods to get rid of any low quality or contaminated reads.

4 Instrument Control Software/RTA Data analysis Images Intensities Basecalls A T G C Bcl files CASAVA 1.8 / MSR/ 3 rd party tools Reads Alignments Polymorphisms Biological results Visualize C/A/G/T

5 CASAVA CASAVA is a Linux application designed to: Translate base calls (.bcl files) to compressed, demultiplexed FASTQ files Align reads Call variants (SNPs and indels) Assign genotypes to variants Count expression level for exons, genes and splice junctions in case of RNA-seq runs

6 Demultiplexing overview Demultiplexing can be done by: CASAVA MiSeq Reporter software (for the miseq) Demultiplexing requires a run folder (with bcl files) and a sample sheet Demultiplexing occurs during Bcl to Fastq processing Each index sequence read is compared to the index sequence specified in the sample sheet No quality values are considered in this step

7 How does Demultiplexing occurs? Illumina sequencing instruments generate *.bcl files as primary sequencing output. CASAVA contains a BCL to FASTQ converter(configurebcltofastq.pl) that combines these per-cycle *.bcl files from a run and translates them into FASTQ files. In addition to generating FASTQ files, CASAVA uses a user-created or IEM sample sheet to divide the run output in projects and samples, and stores these in separate directories. If no sample sheet is provided, all samples will be put in the Undetermined_Indices directory by lane, and not demultiplexed

8 Header Description Samplesheet.csv FCID Positive integer indicating lane number (1-8) SampleID ID of sample SampleRef The reference sequence to be used for Sample Index Index sequence Description Description of the sample Control Y indicates lane is control lane N means sample Recipe Recipe used for sequencing Operator Name or ID of operator SampleProject The project the sample belongs to

9 Input Files for configurebcltofastq.pl Run Folder (from RTA or OLB) Files actually required are in the graphic shown SampleSheet.csv User created (Microsoft Excel is easiest) Saved as *.csv format Default directory is in the BaseCalls Directory

10 BCL Conversion and Demultiplexing Invocation Create MakeFiles Builds the run folder structure and generates the MakeFiles cd into the Analysis Directory MakeFiles are created in the analysis directory Execute MakeFiles Start the BCL conversion and Demultiplexing run Command(s) /path/to/casava/bin/configurebcltofastq.pl --input-dir <BaseCalls_DIR> --output-dir <Unaligned> --sample-sheet <Input DIR>/SampleSheet.csv cd /path/to/runfolder/unaligned nohup make j <n> & Nohup command keep even if process interrupted or if you log out. The -j option specifies the extent of parallelization

11 Bcl conversion and Demultiplexing options Selected command line options

12 Demultiplexing output fastq file The fastq files are located in the Unaligned/Project_<ProjectName>/Sample_<SampleNa me> directories Illumina FASTQ files use the following naming scheme: <sample name>_<barcode sequence>_l<lane (0- padded to 3digits)>_R<read number>_<set number (0- padded to 3digits>.fastq.gz In the case of non-multiplexed runs, <sample name> will be replaced with the lane numbers (lane1, lane2,..., lane8) and <barcode sequence> will be replaced with "NoIndex".

13 Demultiplexing Output Files, FastQ 1:N:0:CTTGTA TGAAACCAGTGTTCTTAATTGGCATTTTACACACACACACACAGAATTTAAAAAAAAAATCAAAGGAAATCATTCTAAATGTACTATGATAGCATGTTAAA + =55>7;?::BDADDD@EE88DCD?DFFEFFECBE6666BB=B;<;<-34:;<CB51>=BBEE>EE?3D@??CB->:=:AA8DDDDDDBBE9;,=?:/89<E Character ASCII Value Phred Score Error probability? I

14 Demultiplex stat file

15 Demultiplexing Output Files, Summary File The Demultiplex_Stats file is located in the Unaligned/Basecall_Stats_FCID directory.

16 Troubleshooting indexes Linux command line to determine raw index sequence frequency HWI-BRUNOP20X:994:B809UWABXX:1:1101:13501:2240 1:N:0:CTTGTA TGAAACCAGTGTTCTTAATTGGCATTTTACACACACACACACAGAATTTAAAAAAAAAATCAAAGGAAATCATTCTAAATGTACTATGATAGCATGTTAAA + =55>7;?::BDADDD@EE88DCD?DFFEFFECBE6666BB=B;<;<-34:;<CB51>=BBEE>EE?3D@??CB->:=:AA8DDDDDDBBE9;,=?:/89<E Go to Undetermined_Indices/Sample_lane<n> Command line: gunzip awk sort -c lane1_undetermined_l001_r1_001.fastq.gz \ '{if($2~/:/) {sub(/.*:/,"",$2); print $2}}'\ -n uniq -c sort -n -r > index.list.txt

17 FastQC FastQC provide a simple way to do some quality control checks on raw sequence data. give a quick impression of whether your data has any problems of which you should be aware before doing any further analysis. Main Functions -- Import of data from BAM, SAM or FastQ files (any variant) -- Providing a quick overview to tell which areas there may be problems -- Summary graphs and tables to quickly assess your data

18 Quality check

19 PRINSEQ PRINSEQ can be used to filter, reformat, or trim your genomic and metagenomic sequence data. Fastq files as input Sequence data can be filtered to remove sequence copies, short or long sequences, sequences with N's, low-quality sequences, and much more. Command(s) /path/to/prinseq-lite fastq -out_good out/ fastq_filt" -out_bad null - trim_right 10 -ns_max_p 5 -lc_method dust -lc_threshold 10 -no_qual_header

20 Filtering Before Trimming After Trimming

21 Adaptor Trimming Adaptor trimming done before downstream analysis If the read length is shorter than actual insert size, there is no need to do trimming. --adaptor--masking.fasta file (CASAVA) 21

22 QC and filtering softwares Other softwares performing either of these or both: -- cutadaptor --Trim Galore --Trimmomatic --Sickle/scythe -- Fastx Toolkit 22

23 Thank you!